Skip to Content
-
Sort By: Featured
Glutathione Reductase Assay Kit 100 tests
378.80 € 378.8 EUR
Glutathione Coated Polystyrene Particles 0.5% w/v 4.0size:4.9 µm size: 5 mL
313.00 € 313.0 EUR
Glutathione GSH ELISA Kit size: 96 tests
665.01 € 665.01 EUR
Glucosesize:6size:Phosphate Dehydrogenase Activity Assay size: 100 Tests
610.00 € 610.0 EUR
Glucose Isomerase from Streptomyces murinus , Food Grade, 5,000 U/g size: 1 kg
608.00 € 608.0 EUR
Glucose Assay Kit size: 4×50 mL
225.00 € 225.0 EUR
Glucose Assay Kit size: 96 Tests
671.00 € 671.0 EUR
Glucagon Antibody size: 100 µL
388.75 € 388.75 EUR
Global DNA Methylation ELISA Kit 5’size:methylsize:2’size:deoxycytidine Quantitation size: 96 assays
895.00 € 895.0 EUR
GloMelt Thermal Shift Protein Stability Kit with Rox
830.00 € 830.0 EUR
GloMelt Thermal Shift Protein Stability Kit size: 200 assays, No ROX
400.00 € 400.0 EUR
GloMax® 20/20 Luminometer
10,397.00 € 10397.0 EUR
Gliadorphinsize:7 size: 5mg
430.00 € 430.0 EUR
Gliadin GAFsize:3X IgG ELISA size: 96 Tests
850.00 € 850.0 EUR
Gliadin GAFsize:3X IgA ELISA size: 96 Tests
850.00 € 850.0 EUR
Glass Micropipettes size: Presize:Pulled Microcapillaries for Microfluidic Applications size: 30µm internal diameter 4.5 cm length size: 30 pack
819.00 € 819.0 EUR
Glass Micropipettes size: Presize:Pulled Microcapillaries for Microfluidic Applications size: 20µm internal diameter 4.5 cm length size: 30 pack
819.00 € 819.0 EUR
Glass Micropipettes size: Presize:Pulled Microcapillaries for Microfluidic Applications size: Presize:pulled Micropipettes; Part No. MGMsize:1 x 10µm internal diameter 4.5 cm length size: 30 pack
819.00 € 819.0 EUR
Glass Cover Slides size: 18 mm Circular Glass Cover Slides size: Siliconized
335.00 € 335.0 EUR
Glass Beads 1.0mm size: Glass beads. 1.0mm. 1 lb. Nonsize:sterile.
155.00 € 155.0 EUR
Glass Beads 0.5mm size: Glass beads. 0.5mm. 1 lb. Nonsize:sterile
155.00 € 155.0 EUR
Gifu Anaerobic Broth GAM , 500 g
87.00 € 87.0 EUR
Gibco Bacto Yeast Extract Technical
355.00 € 355.0 EUR
Gibco Bacto Yeast Extract
460.00 € 460.0 EUR
Gibco Bacto Proteose Peptone
560.00 € 560.0 EUR
Gibberellic Acid GA3 Solution 1mg/1ml size: 100 mL
30.00 € 30.0 EUR
Giardia lambliasize:S. cerevisiae Recombinant, titered size: 1 mL,
790.00 € 790.0 EUR
Giardia intestinalis, 150 test
1,015.00 € 1015.0 EUR
Giant Knotweed Extract Standard 98% Resveratrol size: 75 g
480.00 € 480.0 EUR
Giant Knotweed Extract Standard 50% Resveratrol size: 75 g
428.00 € 428.0 EUR
Ghrelin Human Total size: RIA Kit size: 125 Tubes
1,300.00 € 1300.0 EUR
Geotrichum candidum PCR size: 96 Reactions
768.00 € 768.0 EUR
Gentodenz Density gradient medium for cell separation size: 250 grams
230.00 € 230.0 EUR
Gentodenz Density gradient medium for cell separation size: 100 grams
150.00 € 150.0 EUR
Gentamicin Sulphate GM size: 1 g
106.00 € 106.0 EUR
Gentamicin Sulfate USP, 25G
475.00 € 475.0 EUR
Gentamicin Solution 50mg/ml 10ml
85.00 € 85.0 EUR
Gentamicin Cn 30 µg size: 5x50 Disc
86.40 € 86.4 EUR
Gentamicin size: 10 mL
184.00 € 184.0 EUR
Genorise® Plasma/Serum DNA Extraction Kit size: 50 Tests
381.00 € 381.0 EUR
Genorise® Blood DNA Extraction Kit size: 200 Tests
675.00 € 675.0 EUR
Genomic DNA Isolation Kitsize:50 assays
569.00 € 569.0 EUR
Genomic DNA size: Mouse Normal Tissue: Brain 100 ug
500.20 € 500.2 EUR
Genipin size: 5G
370.00 € 370.0 EUR
General Vitellogenin, VG ELISA Kit 96 wells
500.00 € 500.0 EUR
General Testosterone ELISA Kit, 96 test
449.00 € 449.0 EUR
General Selenium Assay Kit size: 100 Assays
900.00 € 900.0 EUR
General PTD Pentosidine ELISA Kit size: 96 Tests
480.00 € 480.0 EUR
General Melatonin MT ELISA Kit size: 48T
731.00 € 731.0 EUR
General Heparan sulfate ELISA Kit size: 96 Tests
745.00 € 745.0 EUR
General Estradiol, E2 ELISA Kit, 96 test
479.00 € 479.0 EUR
General Endotoxin ELISA Kit Competitive size: 96 Tests
2,653.00 € 2653.0 EUR
General Cyclic Guanosine Monophosphate cGMP ELISA Kit size: 48 Tests
646.00 € 646.0 EUR
General CML/ N 6 size:Carboxymethyllysine ELISA Kit, 96 tests
558.00 € 558.0 EUR
General Basic Xylanase Assay Kit size: 100 tests
705.00 € 705.0 EUR
General 5size:Hydroxyindoleacetic Acid 5size:HIAA ELISA Kit size: 48 Tests
655.00 € 655.0 EUR
GeneQ thermal cycler, 24x0.2ml
2,527.00 € 2527.0 EUR
GeneMATRIX Gram Plus & Yeast Genomic DNA Purification Kit size: 25 Preps
140.00 € 140.0 EUR
GeneMATRIX Gram Plus & Yeast Genomic DNA Purification Kit size: 100 Preps
375.00 € 375.0 EUR
Gene Synthesis size: Per bp size: 5'UTR sequence from Custom gene: 5'size:CTATCACCTAAGTGTGGGCTAATGTAACAAAGAGGGATT TCACCTACATCCATTCAGTCAGTCTTTGGGGGTTTAAAGA AATTCCAAAGAGTCATCAGAAGAGGAAAAATGAAGGTAATGTTTTTTCAGACAGGTAAAGTCTTTGAAAATATGTGTAATAT GTAAAACATTTTGACACCCCCATAATATTTTTCCAGAATTAA CAGTATAAATTGCATCTCTTGTTCAAGAGTTCCCTATCACT CTCTTTAATCACTACTCACAGTAACCTCAACTCCTGCCAC A size:3' 285bp + 60 bp cloning sites = 345bp Not a deliverable. Use for C452.
300.00 € 300.0 EUR
Gene Synthesis size: Per bp 1640 bp + 60 bp cloning sites
250.31 € 250.31 EUR
GenMute siRNA Transfection Reagent size: 1 mL
264.00 € 264.0 EUR
GenJet In Vitro siRNA Transfection Reagent Ver. II size: 1 mL
331.00 € 331.0 EUR
Gemcitabine, Free Base, >99%, 500 mg
284.00 € 284.0 EUR
Gem21 NeuroPlex Supplement without Vitamin A, 10 ml
359.00 € 359.0 EUR
Gellan Gum 500g
79.99 € 79.99 EUR
Gellan Gum size: 100 g
36.99 € 36.99 EUR
Gellan Gum size: 1 kg
114.99 € 114.99 EUR
Gelatin from porcine skin, gel strength 300, Type A size: 100 g
120.00 € 120.0 EUR
GelRed® Prestain Plus 6X DNA Loading Dye size: 1 mL
146.28 € 146.28 EUR
GelRed® Nucleic Acid Gel Stain trail size size: 0.1 ml
164.00 € 164.0 EUR
GelRed® Nucleic Acid Gel Stain 10.000X in DMSO size: 0.5 mL
278.00 € 278.0 EUR
GelRED TM for Agarose or Page Gels 10000X in water size: 0.5 mL
229.00 € 229.0 EUR
GelNest Matrix, low growth factor, without Phenol Red
1.00 € 1.0 EUR
GelGreen® Nucleic Acid Stain, 10,000X in water size: 0.1 ML
222.40 € 222.4 EUR
GelGreen® Nucleic Acid Gel Stain, 10000X in water, 0.5 ml
277.00 € 277.0 EUR
GelGreen® Nucleic Acid Gel Stain size: 10 mL, 10,000X in water
2,400.00 € 2400.0 EUR
GelGreen® Nucleic Acid Gel Stain size: 10 mL, 10,000X in water
2,640.00 € 2640.0 EUR
GelGreen Nucleic Acid Gel Stain, 10,000X in DMSO size: 0.5ML
275.00 € 275.0 EUR
Gelsize:Bright Laser Diode Gel Illuminator
2,480.00 € 2480.0 EUR
Gel Drying Film
222.50 € 222.5 EUR
Gammasize:ECS | Gamma glutamylcysteine synthase
710.00 € 710.0 EUR
Gammasize:Aminobutyric Acid gABA ELISA Kit size: 96 tests
1,050.00 € 1050.0 EUR
GZMK recombinant protein :: Granzyme K Recombinant Protein, 0.1 mg
655.00 € 655.0 EUR
GW2580, Free Base, >99% size: 10g
2,703.37 € 2703.37 EUR
GVB++ with Ca and Mg size: 1L
636.00 € 636.0 EUR
GV3101 AGROBACTERIUM STRAIN
530.00 € 530.0 EUR
GV3101 pSoupsize:p19 ElectroCompetent Agrobacterium size: 6x50µl
779.00 € 779.0 EUR
GV3101 pSoupsize:p19 ElectroCompetent Agrobacterium
694.00 € 694.0 EUR
GV3101 pSoup ElectroCompetent Agrobacterium size: 6x50ul
779.00 € 779.0 EUR
GUINEA PIG, WHOLE BLOOD, ALSEVERS, DONOR, GENDER UNSPECIFIED, 100 ML
1,276.00 € 1276.0 EUR
GTP Tris Solution GMPsize:grade 100 mM size: 1ml
213.00 € 213.0 EUR
GT elisa kit :: Rat Glutathione ELISA Kitsize:96size:Stripsize:Wells
1,035.00 € 1035.0 EUR
GSTp active protein :: Glutathione S Transferase Pi GSTp Active Protein size: 0.1 mg
890.00 € 890.0 EUR
GSTm1 recombinant protein :: Glutathione S Transferase Mu 1 GSTm1 Recombinant Protein size: 0.1 mg
737.00 € 737.0 EUR
GSTA1 active protein size: 0.1 mg
627.00 € 627.0 EUR
GST assay kit :: Glutathione Ssize:Transferase GST Assay Kit size: 96 tests
386.00 € 386.0 EUR
GSSG elisa kit :: Rat Oxidized Glutathione ELISA Kitsize:96size:Stripsize:Wells
1,035.00 € 1035.0 EUR
GSKsize:3β Rabbit mAb,100 µg
320.00 € 320.0 EUR
Your Dynamic Snippet will be displayed here... This message is displayed because you did not provided both a filter and a template to use.